                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.00 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=20 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TTCATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTAAGTCATACATTGTTCTTCATTATTTTAGTTGTAGCATTTGGAGCAACATT
TATACTTCACTACGTGAAGAATTCTGGACAAGCTAAAGAAGAAGTTGCAGCTACTAAA
AATAACCATAAATAAttgaaatgggtttgctcgttttacgagcgcccattttttataactaaaaatagtttataatggaagaaggactt
agaaaaaacgtaaatgtttttggaggtgaactgttGTG

    BT9727_0380 --- BT9727_0381 Gene: BT9727_0380     GI: 49480821     BI number: BT9727_0380     GOG: NOG12025     Description: conserved hypothetical protein, possible tellurium resistance protein Gene: BT9727_0381     GI: 49479047     BI number: BT9727_0381     GOG: COG3853     Description: probable tellurite resistance protei             t           t  t           t  a            gc            cg            ta            cg tt        gc t  g      t  | gc       t  | gt        tg gc        gc tg        gc at        gc at        ta at        at gt        at             ttttataactaaaaatagtttataatggaagaaggacttagaaaaaacgtaaatgtttttggaggtgaactgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3853 Uncharacterized protein involved in tellurite resistance ... can be seen here     ..................................................................................................................