Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-22.70 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -5.83 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G=-15.93 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGTTCGCGGTAAAGGTTTATTCATCGGTATCGAATTAAACGAGCCAGCTCGTCCTT
ACTGTGAACAACTAAAAGCAGCTGGTCTATTATGTAAAGAAACACACGAAAATGTAAT
TCGTATCGCACCACCACTAGTAATCTCTGAAGAAGATTTAGAGTGGGCGTTCCAAAAA
ATTAAAGCGGTATTATCGTAAtaatagagagtctgtcctacacgttaggacagactctttctttttttagtagtttatcgtaaaa
taaattttaatattcggtctttttacgaaaggggtagttatATG

    BT9727_1051


Gene: BT9727_1051     GI: 49480825     BI number: BT9727_1051     GOG: -------     Description: hypothetical protei


 GA
T  A
 CG
 TA
|  A
 CG
 TA
 AT
 AT
T  T
G  A
A  G
 TA
 CG
 AT
 CG         T
 CG       A  T
A  G       TA
C  C       GT
 CG        GC
 AT        CG
|  T       GT
|  C      A  A
|  C      A  A
|  A       At         c
|  A       Ta       a  g
|  A       Ta       c  t
|  A       At        at
|  A      A  a       ta
|  A      A  g       cg
|  T      A  a       cg
|  T      A  g       ta
|  A      A  a       gc
|  A      C  g       ta
|  A      C  t       cg
 CG       T  c       ta
 GC       T  |       gc
 CG        Gt        at
 TG        Cg        gc
 AT        Gt        at
 TA        Gc        gt
 GT        Gc        at
                        ctttttttagtagtttatcgtaaaataaattttaatattcggtctttttacgaaaggggtagttatATG


    ..................................................................................................................