                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-16.12 kcal/mol
Antiterminator:    Distance from promoter:45 nt. Size=44 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:26 nt.    Size=33 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATGAA. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAAGAAGGCGAAGTGTATATGAAGCGTTTAGCAGAAGAGCGCGAGAAACGTAA
TCAGGATAGTGATAAGGATTCTGTATTGCTTTAAtagaaatgttgaaaggctattatctagtagaagtttacatc
taggtggtagcctttttctttttttgggaagcatgtatacgaaattcattatgaacttttattgagggcatttatatatatgtttcttcataagaatgga
actagcggggtattttactggggggggattaaaaATG

    BT9727_0941 Gene: BT9727_0941     GI: 49480875     BI number: BT9727_0941     GOG: NOG12070     Description: conserved hypothetical protei            aa           g  a            at            tg            At            At         t            Tg       g  t            Ta       a  t AT       |  a      a  a G  A      |  a      g  c T  A       Tg       a  a G  G       Cg       t  t A  G       Gc        gc TA       T  |       at AT       T  |       ta GT        At        cg GC        Ta        tg AT        Gt        at CG       T  t       tg |  T      C  |       tg TA       T  |       at AT        Ta        ta AT        At        cg TG        Gc        gc GC        Gt        gc                         tttttctttttttgggaagcatgtatacgaaattcattatgaacttttattgagggcatttatatatatgtttcttcataagaatggaactagcggggtattttactggggggggattaaaaATG     ..................................................................................................................