                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:9 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.44 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCCAGAAGATCTCGAAGTTGGTGAAGGATCTGTCGTACATGTTAACGGGAAACGAG
CAGGTGCTTATAAAGACAAAGAAGGAAAATTACATATTGTCGATACAACTTGTACACA
TCTCGGCTGCGAAGTTGAGTGGAATAATGGTGATTGCACTTGGGATTGTCCTTGTCAC
GGTTCCCGCTTTTCAATTGAGGGAGACGTTATTGAAGGTCCAGCAGATCAACCGTTAA
AGCGAGTTGATAATGAGTAAacaattaaagaagttcaacagagttcctgttgaacttctttaatagggATG

    BT9727_0332 Gene: BT9727_0332     GI: 49480894     BI number: BT9727_0332     GOG: -------     Description: sugar transporter; possible benzoate transport protei            ca           a  a            At            At            Ta AA       G  a T  A      A  a TG       G  g GC       T  a CG       A  a |  A      A  g CG       T  t        t AT        At       g  t AT        Gc       a  c CG        Ta        gc TA        Ta        at AT        Gc        cg G  A      |  a       at A  A      A  g       at C  |      G  a       cg G  |       Cg        ta AT        Gt        ta CG        At        gc                         ttctttaatagggATG     ..................................................................................................................