                                                                        Gene putatively regulated by attenuation in B_thuringiensis_konkukian

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=27 nt.     Delta G= -3.22 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAATAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGAATTAATGAAGAAGTGTAATATGTTTGGATATGGGGAAGTAAACCAGTACAA
CCGCCATAGTACACTTATGTCAGCCTATAAAAATATTAAAGATGAGAATTTCAGATAT
TATATTTTAAAGCAAAAAGCAGATGTATTCCATGCGATGAAGAGCTTTTTTAGAGAAG
AATCAGGAGAGAAAATGGCATAAcctcttttaaagaggttctttttttgtaaactttttatttttttgattgacaatgataat
gaaaatcattatcatttattcgagaaATG

    BT9727_0463 Gene: BT9727_0463     GI: 49481764     BI number: BT9727_0463     GOG: -------     Description: possible internalin protei   G G  C T  A A  T A  A A  A        t A  c      t  a Gc        ta At        ta Gc        cg At        ta Gt        cg Gt        cg At        At             tctttttttgtaaactttttatttttttgattgacaatgataatgaaaatcattatcatttattcgagaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:167 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.20 kcal/mol Antiterminator:    Distance from promoter:129 nt. Size=27 nt.     Delta G= -3.22 kcal/mol Anti-antiterminator:    Distance from promoter:101 nt.    Size=37 nt.     Delta G= -4.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAG-TAATAT. It has a score value of 69.61 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAGAATTAATGAAGAAGTGTAATATGTTTGGATATGGGGAAGTAAACCAGTACAA CCGCCATAGTACACTTATGTCAGCCTATAAAAATATTAAAGATGAGAATTTCAGATAT TATATTTTAAAGCAAAAAGCAGATGTATTCCATGCGATGAAGAGCTTTTTTAGAGAAG AATCAGGAGAGAAAATGGCATAAcctcttttaaagaggttctttttttgtaaactttttatttttttgattgacaatgataat gaaaatcattatcatttattcgagaaATG     BT9727_0463 Gene: BT9727_0463     GI: 49481764     BI number: BT9727_0463     GOG: -------     Description: possible internalin protei AT C  G C  C TG TA AT         G TG       A  A G  A      G  A T  A      A  G A  G      T  A        t G  A      T  A      t  a A  |      T  T       ta CG        TC        ta GC        TA        cg AT        TG        ta AT        CG        cg AT        GA        cg AT        AG        At AT        GA        At                         ctttttttgtaaactttttatttttttgattgacaatgataatgaaaatcattatcatttattcgagaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thuringiensis_konkukian                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:167 nt.    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.20 kcal/mol Antiterminator:    Distance from promoter:129 nt. Size=27 nt.     Delta G= -3.22 kcal/mol Anti-antiterminator:    Distance from promoter:80 nt.    Size=37 nt.     Delta G= -4.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAG-TAATAT. It has a score value of 69.61 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAGAATTAATGAAGAAGTGTAATATGTTTGGATATGGGGAAGTAAACCAGTACAA CCGCCATAGTACACTTATGTCAGCCTATAAAAATATTAAAGATGAGAATTTCAGATAT TATATTTTAAAGCAAAAAGCAGATGTATTCCATGCGATGAAGAGCTTTTTTAGAGAAG AATCAGGAGAGAAAATGGCATAAcctcttttaaagaggttctttttttgtaaactttttatttttttgattgacaatgataat gaaaatcattatcatttattcgagaaATG     BT9727_0463 Gene: BT9727_0463     GI: 49481764     BI number: BT9727_0463     GOG: -------     Description: possible internalin protei AG A  C A  A TA TA TA         G TA       A  A A  G      G  A T  C      A  G A  A      T  A        t T  G      T  A      t  a T  |      T  T       ta AA        TC        ta TT        TA        cg AG        TG        ta GT        CG        cg AA        GA        cg CT        AG        At TT        GA        At                         ctttttttgtaaactttttatttttttgattgacaatgataatgaaaatcattatcatttattcgagaaATG     ..................................................................................................................