                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGACGGTCACTACACGCTGACGGTCACTACGCAATACAGTGGTACAAATACATTG
CTGAAAACTCCGCGTAGTACGAGCAAAGTGATTACCATCGGGCAAAGTGGTGGTTCTG
AAGGTGGAAATACCAGTGATGGAAACTTGGATGAGAATCCTTTAGGATAAagcctcttatccg
gcctttttagacagagctgtctaaggagattagatagggctatctaaagctcttcgataaagcggtttcagacatcaaaacaaatgctttctttcattga
ataatttgaaataataaaagaATG

    BT0004 --- BT0005 Gene: BT0004     GI: 29345414     BI number: BT0004     GOG: -------     Description: hypothetical protein Gene: BT0005     GI: 29345415     BI number: BT0005     GOG: COG0186     Description: 30S ribosomal protein S1 GC G  A G  A C  A TG AT CG CG AT TG TG AT GT T  | G  | A  | A  | A  | C  | G  | A  |        G G  |      T  G C  |      A  A A  |      G  A       TT T  |       TA       T  A GC        GC        CG AT       |  T       CG TG        AT        TA |  A       CG        AT |  A       CG       |  A G  G      A  |      |  A CG        TA       |  a GT        AT       |  g CG       |  G      |  c CG       A  A      |  c TA       A  G       At C  A      G  A       Gc A  A      G  A       At A  T      T  T       Gt A  A       GC        Ta A  C       GC        At GC        AT        Gc TA        AT        Gc CG        GT        Tg GT        TA        Tg                         cctttttagacagagctgtctaaggagattagatagggctatctaaagctcttcgataaagcggtttcagacatcaaaacaaatgctttctttcattgaataatttgaaataataaaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0186 Ribosomal protein S17 ... can be seen here     ..................................................................................................................