                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAGCGATAATTCTGCAACTTACACCATTTCTATGGCCGACTACGATGCTCTTGACC
TAAGTGAATCTTATTCGGCAAGAGATCTTATCGGACAGAAAGACGCAGGAACCCTTTC
TGCTTCGTCATCGTTGACCGGCTCGCTTGCGGCACACGGCACCTTTGTCGTAAGGCTG
AAAAAGCAGTAAgcctggctcttgcttctaagcaagaaattttcttattcttggcatcaatacttttcggaggctatcagtgccaagagta
atataaagaaacaaatcattaacagttgattgaatATG

    BT0066 Gene: BT0066     GI: 29345476     BI number: BT0066     GOG: COG2885     Description: major outer membrane protein Omp            AG           A  C           A  A           A  G           A  T           G  A            TA            Cg            Gc            Gc CT        At C  T      A  | AT       T  | CG       G  | GT        Cg GC        Tg CG        Gc        ct AT       T  t      t  a |  A      T  c       ta C  A      T  t       cg A  G      C  |       gc CG       C  |       ta GC        At        ta GT        Cg        cg CG        Gc        ta                         aattttcttattcttggcatcaatacttttcggaggctatcagtgccaagagtaatataaagaaacaaatcattaacagttgattgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2885 Outer membrane protein and related peptidoglycan-associated (lipo)proteins ... can be seen here     ..................................................................................................................