                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -6.03 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaaaatagccacgcaatagtctgatacacaataattattggagatacgtggtccgctcctgcggacagcaagttgtcttttgggtaaacgaaaaccaga
cggtttaacagcgcgttacgccgttaaaccgttagcccttccaagctccagagtcgcttcatcatataatttgatagcttcacctatattatcacttggg
acgtttaccaacagactccctttccttttttctgttcgatgccctacaaaaaggctgtttgcggccgcttatttccgtttattttcactatttttgcagt
ATG

    BT0074 --- BT0073 --- BT0072 Gene: BT0074     GI: 29345484     BI number: BT0074     GOG: -------     Description: hypothetical protein Gene: BT0073     GI: 29345483     BI number: BT0073     GOG: COG1132     Description: putative ABC transporter, ATP-binding protein Gene: BT0072     GI: 29345482     BI number: BT0072     GOG: COG4988     Description: putative ABC transporter, ATP-binding protei             t           g  t           t  c            cg            ta           |  t           |  g           |  c           t  c           t  c           t  t           t  a           t  c           c  a           c  a ca        ta c  a       ta a  c       ta ta        cg tg        cg ta       c  c       tt gc       t  t      t  g c  |       cg        gc at        at        tg gc        gt        cg gc        at        gc gc        cg        gc                         gcttatttccgtttattttcactatttttgcagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here [CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:15 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -6.80 kcal/mol Antiterminator: Size=50 nt.     Delta G= -6.03 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ggaaaatagccacgcaatagtctgatacacaataattattggagatacgtggtccgctcctgcggacagcaagttgtcttttgggtaaacgaaaaccaga cggtttaacagcgcgttacgccgttaaaccgttagcccttccaagctccagagtcgcttcatcatataatttgatagcttcacctatattatcacttggg acgtttaccaacagactccctttccttttttctgttcgatgccctacaaaaaggctgtttgcggccgcttatttccgtttattttcactatttttgcagt ATG     BT0074 --- BT0073 --- BT0072 Gene: BT0074     GI: 29345484     BI number: BT0074     GOG: -------     Description: hypothetical protein Gene: BT0073     GI: 29345483     BI number: BT0073     GOG: COG1132     Description: putative ABC transporter, ATP-binding protein Gene: BT0072     GI: 29345482     BI number: BT0072     GOG: COG4988     Description: putative ABC transporter, ATP-binding protei             t           g  t           t  c            cg            ta           |  t           |  g           |  c           t  c           t  c           t  t           t  a           t  c           c  a           c  a at        ta t  t       ta a  a       ta tt        cg cc        cg ca       c  c       tt ac       t  t      t  g c  |       cg        gc tt        at        tg tt        gt        cg cg        at        gc gg        cg        gc                         gcttatttccgtttattttcactatttttgcagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here [CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:26 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -6.80 kcal/mol Antiterminator: Size=50 nt.     Delta G= -6.03 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ggaaaatagccacgcaatagtctgatacacaataattattggagatacgtggtccgctcctgcggacagcaagttgtcttttgggtaaacgaaaaccaga cggtttaacagcgcgttacgccgttaaaccgttagcccttccaagctccagagtcgcttcatcatataatttgatagcttcacctatattatcacttggg acgtttaccaacagactccctttccttttttctgttcgatgccctacaaaaaggctgtttgcggccgcttatttccgtttattttcactatttttgcagt ATG     BT0074 --- BT0073 --- BT0072 Gene: BT0074     GI: 29345484     BI number: BT0074     GOG: -------     Description: hypothetical protein Gene: BT0073     GI: 29345483     BI number: BT0073     GOG: COG1132     Description: putative ABC transporter, ATP-binding protein Gene: BT0072     GI: 29345482     BI number: BT0072     GOG: COG4988     Description: putative ABC transporter, ATP-binding protei             t           g  t           t  c            cg            ta           |  t           |  g           |  c           t  c           t  c           t  t           t  a           t  c           c  a           c  a at        ta t  t       ta a  a       ta tt        cg cc        cg ca       c  c       tt ac       t  t      t  g c  |       cg        gc tt        at        tg tt        gt        cg cg        at        gc gg        cg        gc                         gcttatttccgtttattttcactatttttgcagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here [CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here     ..................................................................................................................