                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagttaatcgttccctgtctctccgcagaacctactggacaaaacaggacagtaagtggacaaaaacctacaaatcagcgatttgtaggttttttttatt
gcctataagtcttgtttccaagacaacaaaaggactataaaagacatagtttcgttactaaatcgttacctattccctaccggacaaaaacggtaacgat
ttgtcccgaaatgaccgcagaaagtctgaatttgtccaccgtctatctatctcacatttaacaagttattagtagttttgcaacttaaaaatgtgaggtt
ATG

    BT0076 Gene: BT0076     GI: 29345486     BI number: BT0076     GOG: COG4974     Description: transposas   g a  c       tt cg       t  t ta       t  a at       t  t at       t  t at        tg cg        gc at        gc ta        at cg        ta cg        gt at        ta at        ta at        tg at        at at        gc             ttgtttccaagacaacaaaaggactataaaagacatagtttcgttactaaatcgttacctattccctaccggacaaaaacggtaacgatttgtcccgaaatgaccgcagaaagtctgaatttgtccaccgtctatctatctcacatttaacaagttattagtagttttgcaacttaaaaatgtgaggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4974 Site-specific recombinase XerD ... can be seen here     ..................................................................................................................