                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCCACGCAAACCGATAGGATATAGAACCTATGATGAATAAcggtttaaggtattcggttgtctaagg
ggtgtcatcagtgatacccctttttcagttccctaaagtaatgtatctcaatcacaaattttagcaaagttacagcccggcagggacaaataccaaatcc
gagccgttccggttttctaaaaaatctccacacctacgggtcgtattttttgaaaagattaggttgaagtccccgccaaactgtgggtgtccggcaaaat
ttcttattgtttaatttaaaattcaagtgttATG

    BT0078 Gene: BT0078     GI: 29345488     BI number: BT0078     GOG: COG2003     Description: putative DNA repair protei            cg           t  g           t  t            at            tg            gt            gc           a  |            at            ta            ta            tg   A       g  g G  T      g  g T  G       cg        ca G  A       At       t  g TA       A  g       at AT       T  |       cg tA       A  |       ta tA        At        gt gc        Gc        ta tg        Ta        gc g  g       At        gc at        Gc        gc at        Ta        gc                         tttttcagttccctaaagtaatgtatctcaatcacaaattttagcaaagttacagcccggcagggacaaataccaaatccgagccgttccggttttctaaaaaatctccacacctacgggtcgtattttttgaaaagattaggttgaagtccccgccaaactgtgggtgtccggcaaaatttcttattgtttaatttaaaattcaagtgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2003 DNA repair proteins ... can be seen here     ..................................................................................................................