                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGCTGAAAATGTCCGATGGGACGGTTTTACTGCCGAATGACCTGTACCCGCTTCC
GGGTGAAACATTCCGGCTTTACTATACCTCTGCATCCACCGACCAGCAAACGGTAGAT
GTGTATTTTCAGGACAGCTTCGGGCAGTTGCAGCAGCTTACATTTTCGTTCAATAATG
ATAGCAGTAAAGAGGAGGAATAAcctttttgtgtaaatgtgttaagaaacattcagcaatatattgttgagtgtttcttttta
tctacttttgtataaaagtttaagtattaaaaatgaattatatATG

    BT0083 Gene: BT0083     GI: 29345493     BI number: BT0083     GOG: NOG42097     Description: conserved hypothetical protei AA        aa G  T      t  g G  A      t  a A  A      g  a       at Gc        ta       t  a Gc        gc        at At        ta        at Gt        at        cg At        at        gt At       a  c       at At       t  a       cg Tg       g  |       ta G  |       tg        tg At        gc        at Cg        ta        cg Gt        ta        at                         ttctttttatctacttttgtataaaagtttaagtattaaaaatgaattatatATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol Antiterminator: Size=31 nt.     Delta G= -4.50 kcal/mol Anti-antiterminator:   Size=20 nt.     Delta G= -3.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAACGCTGAAAATGTCCGATGGGACGGTTTTACTGCCGAATGACCTGTACCCGCTTCC GGGTGAAACATTCCGGCTTTACTATACCTCTGCATCCACCGACCAGCAAACGGTAGAT GTGTATTTTCAGGACAGCTTCGGGCAGTTGCAGCAGCTTACATTTTCGTTCAATAATG ATAGCAGTAAAGAGGAGGAATAAcctttttgtgtaaatgtgttaagaaacattcagcaatatattgttgagtgtttcttttta tctacttttgtataaaagtttaagtattaaaaatgaattatatATG     BT0083 Gene: BT0083     GI: 29345493     BI number: BT0083     GOG: NOG42097     Description: conserved hypothetical protei                      at            tt       t  a           t  g       at           t  t       at           t  g       cg            ct        gt            ca        at AA        Aa        cg G  T       Aa        ta G  A       Tt        tg A  A      A  g       at Gc       A  t       cg Gc       G  |       at At        Gg        at Gt        At        at At        Gt        gc At        Ga        at                         ttttatctacttttgtataaaagtttaagtattaaaaatgaattatatATG     ..................................................................................................................