                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatatataacatagcgttcgcagaacgtctcaacgtagaaaactggtaattttcaaagagaagagatttatgcgcaatgttcatgctatacttctgtata
gcgtgggcttgcctgtttcttctcttaggcgtaccagtgcctctacgttggaatagtgtgagttcacgctttttttagacgtactggcgaacagtttata
actaaaaactgtttgataccaacttatgaaacatttaaaaacttgtattgctgtatctctcgatggcttcattgcccgaaaagataatgatttggactgg
ATG

    BT0106 Gene: BT0106     GI: 29345516     BI number: BT0106     GOG: COG0262     Description: conserved hypothetical protei            tc           c  t           c  a tt        gc c  c       tg t  t       gt t  c       at t  t       cg gt        cg ta       |  a cg       a  a cg       t  t gc       g  a       gt tg        cg       a  t t  t       gt        gc c  a      g  g       ta g  |       at        gc gc        tg        tg gc        ta        gc ta        cg        at                         ttttttagacgtactggcgaacagtttataactaaaaactgtttgataccaacttatgaaacatttaaaaacttgtattgctgtatctctcgatggcttcattgcccgaaaagataatgatttggactggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0262 Dihydrofolate reductase ... can be seen here     ..................................................................................................................