Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:10 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ctcaaa-taaaat. It has a score value of 65.6 and is shown in blue

ctcaaaacagatggtttttaggctaaaatcctcaaaaaaataaatcttccaacttggaaagaggttggaagatttattttttcaaatgcttcaactttgc
agcaaatcaattagttagcaaaATG

    BT0109 --- BT0108 --- BT0107


Gene: BT0109     GI: 29345519     BI number: BT0109     GOG: -------     Description: conserved hypothetical protein
Gene: BT0108     GI: 29345518     BI number: BT0108     GOG: NOG44874     Description: conserved hypothetical protein
Gene: BT0107     GI: 29345517     BI number: BT0107     GOG: -------     Description: conserved hypothetical protei


          aa
         g  a
         g  g
          ta
          tg
          cg
          at
          at
          cg
          cg
          ta
          ta
          cg
          ta
          at
          at
          at
          ta
          at
            tttttcaaatgcttcaactttgcagcaaatcaattagttagcaaaATG
    ..................................................................................................................