Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:61 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTAACT-TAAaat. It has a score value of 63.59 and is shown in blue

GTAACTCTTGCGGATGCTGTGGCTAAaatcattcatcaatattctgtttgaaaggaaactaacttaatacaattttttaat
tggctatctaatgtaggaagtatgctcacatactttctacatttatttattgtatattaaaatataaaaataaacttctatttgcaatataaatgacaga
agaatatatgacATG

    BT0110


Gene: BT0110     GI: 29345520     BI number: BT0110     GOG: -------     Description: putative regulatory protei


          tc
         c  a
          gc
          ta
          at
          ta
          gc
          at
          at
          gt
          gc
          at
          ta
          gc
          ta
          at
          at
            tatttattgtatattaaaatataaaaataaacttctatttgcaatataaatgacagaagaatatatgacATG
    ..................................................................................................................