                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAAGTTGTTTCTTCGGAGATATTCACGAAGTACTACCCATTGCTAAAGCAACCGTT
TCGCAGCATTTAAAAGAACTGAAAGATGCAGGGTTAATTCAGGGGGAAATAGAAACAC
CAAAAGTTCGGTATTGTATCAACCGAGAGAATTGGGAACTTGCCCGTAAATTATTTGC
TGCATTTTTGGGTGATTGTAAATGTACGGGTACATCGTGCTGTGGATAAcagcacctttttttg
agaataatgttcgtagttctacgaattacgattggtatattaactttataattgaatagaaaATG

    BT0120 --- BT0119 --- BT0118 --- BT0117 --- BT0116 --- BT0115 --- BT0114 --- BT0113 --- BT0112 --- BT0111 Gene: BT0120     GI: 29345530     BI number: BT0120     GOG: COG0526     Description: conserved hypothetical protein Gene: BT0119     GI: 29345529     BI number: BT0119     GOG: -------     Description: hypothetical protein Gene: BT0118     GI: 29345528     BI number: BT0118     GOG: COG0785     Description: putative cytochrome c biogenesis protein Gene: BT0117     GI: 29345527     BI number: BT0117     GOG: NOG15998     Description: arsenical resistance operon trans-acting repressor Gene: BT0116     GI: 29345526     BI number: BT0116     GOG: COG0003     Description: arsenical pump-driving ATPase Gene: BT0115     GI: 29345525     BI number: BT0115     GOG: COG0394     Description: arsenate reductase Gene: BT0114     GI: 29345524     BI number: BT0114     GOG: COG0798     Description: putative symporter, arsenic resistance membrane protein Gene: BT0113     GI: 29345523     BI number: BT0113     GOG: -------     Description: hypothetical protein Gene: BT0112     GI: 29345522     BI number: BT0112     GOG: COG0701     Description: putative permease Gene: BT0111     GI: 29345521     BI number: BT0111     GOG: -------     Description: hypothetical protei            AT           A  G            AT            TA            GC            TG            TG           |  G           |  T           A  A TT        GC T  G       TA TG        GT TG        GC AT       G  | CG       T  | |  A      T  |        A G  T      T  |      G  T T  T      T  |      G  A CG        TG        TA GT        AT        Gc TA        CG        Ta TA        GC        Cg TA       T  T       Gc AT        CG        Ta TG        GT        Gc                         ctttttttgagaataatgttcgtagttctacgaattacgattggtatattaactttataattgaatagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here [O] COG0785 Cytochrome c biogenesis protein ... can be seen here [P] COG0003 Oxyanion-translocating ATPase ... can be seen here [T] COG0394 Protein-tyrosine-phosphatase ... can be seen here [P] COG0798 Arsenite efflux pump ACR3 and related permeases ... can be seen here [R] COG0701 Predicted permeases ... can be seen here     ..................................................................................................................