                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGTGTCCTCTTCCAGTACCAATGAGGCGAATGTTCCGGAAAGTTCAGCCGGTAAGT
ATACCTATAAAGATATTCGTGATGACCGGGTATTGACTTATTTCGACCTGCGACGGGG
TGAATCGAAAACATTTACCGTAAGGTTGCAGGCAACTTATGCAGGTAACTTTATTCTT
CCGGCCATTCAGTGCGAAGCTATGTACGACGCAGCGGTACAGGCACGCACCAAAGCGG
GAAGAACGACTGTCAGCCGCTGAcaagactctgaacaataagacagcattgacagatagcataagtgcATG

    BT0162 --- BT0161 Gene: BT0162     GI: 29345572     BI number: BT0162     GOG: COG4953     Description: penicillin-binding protein 1C (PBP-1c) Gene: BT0161     GI: 29345571     BI number: BT0161     GOG: COG0477     Description: putative permeas             A           A  A           G  A           C  C            TA            AT            AT        AG            GT       C  G            TA        GC TG        GC        TA C  C       GC        TA C  G      |  G       GC A  A      |  T       GT GC       |  A       AT CG       G  A      |  A T  G      G  G       AT T  G       CG        TG TG        AT        GC AT        GT       |  A TG        CG        CG TA        GC        CG C  A       TA        AT AT        CG        TA GC        CG        TA                         CTTTATTCTTCCGGCCATTCAGTGCGAAGCTATGTACGACGCAGCGGTACAGGCACGCACCAAAGCGGGAAGAACGACTGTCAGCCGCTGAcaagactctgaacaataagacagcattgacagatagcataagtgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4953 Membrane carboxypeptidase/penicillin-binding protein PbpC ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................