Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -5.12 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -5.07 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTACCGCTGACTTCTACACAGATAACGGTAGTGAAAATTACAATGTTACTAAAGAAG
GCAATCAATACATTCTTTCAAGCGAAAGCTCATCTGGTATCAACATAACTGTTACAGG
TAAAGCAATGACTATAAGTTTCCTTAATAATGCAGGAAGTATGACCACTTTTACCGGA
ACTCGTGATTAAagcccaccaatctttacagtaaaagtagaaattcagtaaaggttacaaatatcccaaagccgtaatttcccttttcttg
aaaatgagaaattacggcttttataaataaaagctATG

    BT0171


Gene: BT0171     GI: 29345581     BI number: BT0171     GOG: -------     Description: conserved hypothetical protei


            a
          t  t
          a  c
          a  c
          a  c
          c  a
          a  a
           ta
           tg
           gc
           gc
          a  g
          a  t
          a  |
          t  |
          g  |       tt
          a  |      c  g
 ta       c  |       ta
g  g       ta        ta
a  a       ta        ta
a  a       at        ta
a  a       at       |  t
a  t       at       c  g
t  t       gc       c  a
g  c      a  c       cg
a  a      t  |       ta
 cg        gc        ta
 at        at        ta
 ta        at        at
 ta        at        at
 ta        at        ta
 cg       t  c       gc
 tg        gt        cg
 at        at        cg
 at        cg        gc
                        ttttataaataaaagctATG


    ..................................................................................................................