                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGATGAAATAACGCAGATTGCCGCTATCAAATAATGTATATCAACCTGATTGAGTT
CCATaaaatttatatttcagataacaacaaagcaacgaatagatagttcgacacatagtaatctttcacaaatgcaatcccgacttagcaaacgaag
aaaaaacgtaaacggatttgtcacttttcacaaaaaagtaagatatggcgatttgcagaaacaaataaatcgactacctttgtgggcgatttagagaatc
gtgactacgtatttttaattatatcactaaaaaaaagagctaattATG

    BT0174 --- BT0173 Gene: BT0174     GI: 29345584     BI number: BT0174     GOG: COG0822     Description: conserved hypothetical protein Gene: BT0173     GI: 29345583     BI number: BT0173     GOG: NOG10616     Description: conserved hypothetical protei aa                   g a  c                a  a g  a       tt        tg a  a      c  t       ta c  a       cg        ta gt        at        at ta        tg        gc ta        cg        cg ta       a  g       gt at        gc       |  g gc        cg       |  a cg        ta        gc |  a       at        gt gc        at        ta gt        at        gc ta        ta        tg                         tatttttaattatatcactaaaaaaaagagctaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here     ..................................................................................................................