                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:115 nt.    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.20 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=57 nt.     Delta G=-17.00 kcal/mol
Anti-antiterminator:    Distance from promoter:38 nt.    Size=57 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggaa-tacttt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggaagtatcaaacaaatgctttacttttgtcgcattaaataaaagaaatatgaaatatacagttgcacatcatcatcatcattttcctaacgaataac
tcggtgggcgtgattgatagtgtgtataactctataaagataacgaaggcttaccgaatacggtaagcctttttttatttctgaattgttcgaattgtaa
atcataaaataataaataaaatcATG

    BT0200 --- BT0201 --- BT0202 --- BT0203 Gene: BT0200     GI: 29345610     BI number: BT0200     GOG: COG0040     Description: ATP phosphoribosyltransferase Gene: BT0201     GI: 29345611     BI number: BT0201     GOG: COG0141     Description: histidinol dehydrogenase Gene: BT0202     GI: 29345612     BI number: BT0202     GOG: COG0079     Description: histidinol-phosphate aminotransferase Gene: BT0203     GI: 29345613     BI number: BT0203     GOG: COG0131,COG0241     Description: histidine biosynthesis bifunctional protein his             a   a       t  t t  a      g  a a  c       ta at        gc gc       t  t cg        gc a  g       at at        ta tg        at cg       |  a cg       |  a t  c      g  a t  |       tg t  |       ta tg        at at       g  a cg        ta ta        gc        at at       |  g      a  a c  |      |  a       gc t  |      |  a       cg at       |  g       cg cg        cg        at ta        gc        ta at        gt        ta c  a       gt        cg tg        ta        gc at        gc        gc cg        gc        at at        cg        at cg        ta        gt                         ttttatttctgaattgttcgaattgtaaatcataaaataataaataaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0040 ATP phosphoribosyltransferase ... can be seen here [E] COG0141 Histidinol dehydrogenase ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [E] COG0131 Imidazoleglycerol-phosphate dehydratase ... can be seen here [E] COG0241 Histidinol phosphatase and related phosphatases ... can be seen here     ..................................................................................................................