                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTTCCATGATTTGGACTGTAAAAGATGATGATAGTGACGTGAATAAATATGTCCGT
TGCGAAAAAGTACCTGAATCAATAATCGAAGAGGCTAAAACCAACAAGAATTAAggcaaa
atagaggtatatcaatgtctaaaggtcatctttattaagatggccttttttgtatggaagaatttagtaatacatatctgcaaaaaaaatattgatttta
tttggaaatgatattgggactttctatatttgcatcagatttataattgtaatgaatacaactttgaaaagagggagaacttATG

    BT0215 --- BT0216 Gene: BT0215     GI: 29345625     BI number: BT0215     GOG: COG0735     Description: iron uptake regulatory protein Gene: BT0216     GI: 29345626     BI number: BT0216     GOG: COG1592     Description: putative rubrerythri at t  c a  a ta gt        at g  g      t  t at        ta gc        ta at        cg ta        ta a  a       at a  a       cg a  g       tg a  |       gc cg        gc gt        at gc        at             ttttgtatggaagaatttagtaatacatatctgcaaaaaaaatattgattttatttggaaatgatattgggactttctatatttgcatcagatttataattgtaatgaatacaactttgaaaagagggagaacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here [C] COG1592 Rubrerythrin ... can be seen here     ..................................................................................................................