                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.30 kcal/mol
Antiterminator:    Distance from promoter:74 nt. Size=46 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:    Distance from promoter:40 nt.    Size=56 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-TACTGT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATCTGGACGCTATTCACGATACTGTACACGAAATGTGCAAGGACGAAGCTCGTC
ATGGTAAAGGTTTTGAAGGACTTTACAACCGTTATTTCGGAGATAAGAAATAAtaaagcct
tataaataacttttaaaaggtttgtgttctatagtgaatgcagaccttttttgtttatatttgcctatcaactttataaataccacaattatgagaaagg
tacaactattgttcgtttgtttaATG

    BT0217 Gene: BT0217     GI: 29345627     BI number: BT0217     GOG: COG0778     Description: conserved hypothetical protei GA A  T G  A G  A CG TA TA TA         a AT       a  c TA       t  t TA        at Gt        at C  |       at C  |       ta A  |      a  a       ta A  |       ta       a  g C  |       ta       t  t A  |       cg        cg Ta        cg        ta Ta        gt        ta Ta        at        gt Cg        at        tg A  |      a  g       gc Gc       t  t       ta Gc       A  g       tg At       A  |       ta At       T  |       gc |  a      A  |       gc Gt        At        at Ta        At        at Ta        Gc        at Ta        At        at                         ttgtttatatttgcctatcaactttataaataccacaattatgagaaaggtacaactattgttcgtttgtttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here     ..................................................................................................................