                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:119 nt. Size=46 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-aaatat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatattaaagaggaactgcaaatatcccttttcttcatccttacctttgtagccagtaataagcagcaactggcactaacgagaagtttcaagtatga
ttcagagtatgaaatcatattagaacgctaataaagcgtaaaagaaagagtgccagagaacgtaaatgcggtttttacatgcttccgcatctaactttgt
ggaagtttttgaacgaataacaataaaacgaatacaataATG

    BT0232 Gene: BT0232     GI: 29345642     BI number: BT0232     GOG: -------     Description: putative protein involved in transpositio   g c  g g  t t  t at at at ta gc c  a a  t a  g gc        aa at       t  c gt       c  t a  c      t  t c  c       at cg        cg gc        gt ta        cg g  |       cg at        ta gc        ta at        cg             tttttgaacgaataacaataaaacgaatacaataATG     ..................................................................................................................