                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:186 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol
Antiterminator:    Distance from promoter:146 nt. Size=53 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:112 nt.    Size=43 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTGA-TAGTAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTGACCATATTTTGCCCGGATAGTATCCCCAGAAATGAGCTCCTCCTAGTAAAGAG
CCTACAATGGTGACAATCGCTGTAAGAATAGTCAATACCAATAGGATAGGTAAAGCAA
TACAAATTTGATAAATATAATATAGTATCTTCATGGGGAGTTTATTTTTATATATATG
CAAAGATACATGATTATTGGTAAAAAAAGCAGTAGGATACAACATaatctttgcgattatgttattt
ttgtcttctgttatagacagataatgatATG

    BT0244 --- BT0245 Gene: BT0244     GI: 29345654     BI number: BT0244     GOG: COG0420     Description: putative exonuclease Gene: BT0245     GI: 29345655     BI number: BT0245     GOG: COG0419     Description: ATP-dependent exonuclease sbc            AA           A  A           A  A           T  A           G  G   T        GC T  A       TA T  T       TG GT        AT AT        TA GT        TG GT       |  G |  A      |  A |  T      |  T |  A      |  A |  T      |  C G  A      |  A GT       A  A TA        GC         t AT        TA       t  g CG        AT       t  c |  C      C  a       cg |  A      A  |       ta TA        Ta        at TA        At        at CG        Gc        Ta TA        At        At AT        At        Cg TA        At        At GC        Cg        At                         atttttgtcttctgttatagacagataatgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0420 DNA repair exonuclease ... can be seen here [L] COG0419 ATPase involved in DNA repair ... can be seen here     ..................................................................................................................