                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAGATACCTGCGGAACAACAGCTTACAGTCCTTTGATTCCTGCAATCAAAGCTATAT
GCGAGGCTCCTTTCGGTGAAACGCTCGAAATTATCATGAATCATGCAGATGCTTTCCA
AGACTTAAAGGAATATCTTTCCGAGCAAAGCATCGGTTTTCGTGAAATCTATGACGGA
GAGCAAATGACATTGCAATTTACAATCAATGAGAAGTTTTAAaaaaacatcttaatgattgaagttaaa
catcccaatgaataaaaaaatcattgggatgttttttattatccgtatctttgcggcATG

    BT0254 Gene: BT0254     GI: 29345664     BI number: BT0254     GOG: COG1032     Description: putative Fe-S oxidoreductas             A           A  a            Ta            Ta            Ta            Ta            Gc           A  a            At            Gc            At            Gt            Ta TC       A  a A  T       At A  A       Cg A  T       Ta G  G       At TA        At GC        Cg |  G      A  |        a CG        Ta       a  a TA        Ta       a  a TG        Tg       t  a TA        At       a  a TG        At        at GC       |  a       gc G  A      |  a       ta C  A      |  a       at TA       |  c       at AT       |  a       cg CG       |  t       cg |  A      |  c       cg G  C      C  c       ta A  A       Gc        at AT        Ta        cg AT        Ta        at CG        At        at GC        Cg        at                         tttattatccgtatctttgcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................