Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGCTCCCGCATTTCCAGTATTTACTTATGCACGTGGCAATCAGTCGGCAGGCATTGC
TTACAAAGGAGCAGACTATCGCACCTTCGTACTCGGCTTTCCTTTCGAAAGCATTCAG
TCGGAAACAGATCGCGCCAGCATTATGGCCGGGATACTAGGTTTCTTTACTCAGAAAT
AAagtactcacggatataagatttattttctgaaagcccggataaaaatatccgggcttttttaattcgtttttcattttaaattctatctttgctcct
agtaataacccttaaaactaaaaaacgATG

    BT0256 --- BT0255


Gene: BT0256     GI: 29345666     BI number: BT0256     GOG: -------     Description: hypothetical protein
Gene: BT0255     GI: 29345665     BI number: BT0255     GOG: -------     Description: hypothetical protei


 AC
T  T
T  C
 TA
 CG
 TA
 TA
 TA
 GT         a
G  A      t  t
A  A      t  t
 Ta       t  t
 Cg        at
 At        gc
 Ta        at
A  c      |  g       aa
 Gt       a  a      a  a
 Gc       t  a       at
|  a      a  a       ta
 Gc       t  g       at
 Cg       a  c       gc
 Cg        gc        gc
G  a       gc        cg
 Gt        cg        cg
 Ta       a  |       cg
 At        cg        gc
 Ta        ta        at
                        tttttaattcgtttttcattttaaattctatctttgctcctagtaataacccttaaaactaaaaaacgATG
    ..................................................................................................................