                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -8.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGTTGTATGATCAGTTAGGACTGGCATCGTATGAGGCAATGGAGGCATTTGTAGAAT
ACATTCCTCTATAAgaaagaaaattcttaattaatagaatataaaacaatcaaagaagagtgggcagttcgatacttcccactctttttt
tgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaag
gggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG

    BT0257 Gene: BT0257     GI: 29345667     BI number: BT0257     GOG: -------     Description: xanthan lyas tt a  a a  a t  t ta cg ta ta at |  a a  t a  a a  a g  a a  a a  c a  a g  a A  t A  c T  a A  a Ta Cg Ta         g C  a      c  a Cg       t  t Ta        ta Tg        gc At        at Cg       c  t |  g       gc |  g       gc |  c       gc A  a       ta Tg        gc At        at At        gc Gc        at             ttttttgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaaggggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=74 nt.     Delta G= -8.01 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACGTTGTATGATCAGTTAGGACTGGCATCGTATGAGGCAATGGAGGCATTTGTAGAAT ACATTCCTCTATAAgaaagaaaattcttaattaatagaatataaaacaatcaaagaagagtgggcagttcgatacttcccactctttttt tgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaag gggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG     BT0257 Gene: BT0257     GI: 29345667     BI number: BT0257     GOG: -------     Description: xanthan lyas            ag           a  a           g  g           a  t            ag            ag            cg            tc            aa           |  g           a  t           c  t           a  c           a  g           a  a           a           t           a           t           a           a          g           g        c  a            a       t  t aa        t        ta a  t       a        gc at       a         at gc        t       c  t at        t        gc at        a        gc a  a       a        gc g  a       t        ta At       |         gc At       |         at |  a      |         gc Ta       t         at At        c        at Ta        t        gt Cg        t        at Ta        a        at                         ttgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaaggggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.30 kcal/mol Antiterminator: Size=74 nt.     Delta G= -8.01 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACGTTGTATGATCAGTTAGGACTGGCATCGTATGAGGCAATGGAGGCATTTGTAGAAT ACATTCCTCTATAAgaaagaaaattcttaattaatagaatataaaacaatcaaagaagagtgggcagttcgatacttcccactctttttt tgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaag gggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG     BT0257 Gene: BT0257     GI: 29345667     BI number: BT0257     GOG: -------     Description: xanthan lyas            ag           a  a           g  g           a  t            ag            ag            cg            tc            aa           |  g           a  t           c  t           a  c           a  g           a  a           a           t           a           t           a           a           g            a TA        t A  A       a Tg       a Ca        t Ta        t         g Ca        a       c  a C  g       a       t  t T  a       t        ta Ta       |         gc Aa       |         at |  a      |        c  t Ct       t         gc At        c        gc Tc        t        gc At        t        ta At        a        gc                         tctttttttgtttatttttgcaggagattttgccacagaatacaatggacttacatgaacgcgagattcatttcgtattctccttccaaaaggggaaatgccatcaaggggaaagtggcggacatagataatcataggatgcaacctaaagagtggaacgATG     ..................................................................................................................