                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.97 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCGATAAAATTATGTGGAAGCCCCTCGTTCATGGTCACATACGTAATATTATAGCG
GTCGGCAAACCGTTCCTGTGCCCGAACCTGTCCGGCCAGTGAACAGATACTATATATT
ATAAGGTATATAAGTAGGTGTTTTTTCATatatgtacgtattaataagggcaaagttagaagaatctcttcaatcacaa
aaatgggaagagcttcttttcagcagattatcggattgtccaccaatcgtgttcgtatgtccacctttcataggggaaacggggcgtatttttgtagcat
aattgATG

    BT0367 --- BT0368 --- BT0369 Gene: BT0367     GI: 29345777     BI number: BT0367     GOG: COG3507     Description: putative endo-arabinase Gene: BT0368     GI: 29345778     BI number: BT0368     GOG: COG3534     Description: alpha-L-arabinofuranosidase A precursor Gene: BT0369     GI: 29345779     BI number: BT0369     GOG: NOG06523     Description: endo-1,4-beta-xylanase D precurso   c g  t a  t gc at at g  t                 ca g  t                t  t gc                  ta ta         a        tg |  g      a  t       cg |  c      c  c       cg |  a       cg       |  g |  g       at       |  a a  a       cg       |  a a  t      c  t      |  a a  t      t  t      |  c a  a       gc       a  g a  t       tg        cg c  c      |  t       cg a  g      |  a       tg cg       |  t       gc ta        tg        tg at        at        at at        gc        ta cg        gc        gt                         ttttgtagcataattgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3507 Beta-xylosidase ... can be seen here [G] COG3534 Alpha-L-arabinofuranosidase ... can be seen here     ..................................................................................................................