                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:159 nt.    Distance to gene:55 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:141 nt. Size=37 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=67 nt.     Delta G=-25.26 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGGAA-TAAaat. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGAAAGTATCAGAAGATCTCATAAaatagtcctatctgtcatttttgtccttttgtccttttgaagactctctgaaaac
attgggaagtttgaaaaaaccttctcaatgatcggatgcaaacattgggaagattcaatacaatcttctcaatgttttttccttttatcagtgcgtctgt
gtgcgtcactgcacatcacgggcacttgcccatgtagtatctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaa
attATG

    BT0403 Gene: BT0403     GI: 29345813     BI number: BT0403     GOG: -------     Description: hypothetical protei at a  a c  c ta ta at gc at at gc gt gc ta ta at cg at at |  t |  t |  t |  t       ca |  c      t  c |  c       gt        ct |  t       cg       a  t |  t       gc        cg |  t       ta        gc |  t       gc        gc |  a       ta        gc |  t      |  t      c  a |  c       gc       a  | |  a       ta       c  | |  g      |  c      t  | at        cg       a  | cg        tg       c  | gc       g  |       at tg        cg        cg at        gc        gt gc        ta        ta gt        gc        cg cg        at        at                         atctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaaattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:94 nt.    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.30 kcal/mol Antiterminator:    Distance from promoter:62 nt. Size=48 nt.     Delta G=-10.70 kcal/mol Anti-antiterminator:    Distance from promoter:51 nt.    Size=31 nt.     Delta G=-12.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ATGGAA-TAAaat. It has a score value of 71.62 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGGAAAGTATCAGAAGATCTCATAAaatagtcctatctgtcatttttgtccttttgtccttttgaagactctctgaaaac attgggaagtttgaaaaaaccttctcaatgatcggatgcaaacattgggaagattcaatacaatcttctcaatgttttttccttttatcagtgcgtctgt gtgcgtcactgcacatcacgggcacttgcccatgtagtatctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaa attATG     BT0403 Gene: BT0403     GI: 29345813     BI number: BT0403     GOG: -------     Description: hypothetical protei            at           g  g           g  c           c  a           t  a           a  a            gc            ta            at            at aa        cg        at g  a       tg       a  a ta        cg       c  c ta        ta        ta ta        ta        ta |  c       cg        at gc       c  a       gc at       a  |       at at       a  |       at gc       a  |       gc gt       a  |       gt gc        at        gc ta        at        ta ta        gc        ta at        ta        at cg        ta        cg                         ttttttccttttatcagtgcgtctgtgtgcgtcactgcacatcacgggcacttgcccatgtagtatctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaaattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:93 nt.    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.00 kcal/mol Antiterminator:    Distance from promoter:61 nt. Size=48 nt.     Delta G=-10.70 kcal/mol Anti-antiterminator:    Distance from promoter:51 nt.    Size=31 nt.     Delta G=-12.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ATGGAA-TAAaat. It has a score value of 71.62 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGGAAAGTATCAGAAGATCTCATAAaatagtcctatctgtcatttttgtccttttgtccttttgaagactctctgaaaac attgggaagtttgaaaaaaccttctcaatgatcggatgcaaacattgggaagattcaatacaatcttctcaatgttttttccttttatcagtgcgtctgt gtgcgtcactgcacatcacgggcacttgcccatgtagtatctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaa attATG     BT0403 Gene: BT0403     GI: 29345813     BI number: BT0403     GOG: -------     Description: hypothetical protei            ga           g  t           c  g           t  c           a  a           g  a            ta            ac            aa            ct        at aa        tt       a  a g  a       cg       c  c ta        tg        ta ta        tg        ta ta        ca        at |  c       ca        gc gc       a  g       at at       a  |       at at       a  |       gc gc       a  |       gt gt       a  |       gc gc        aa        ta ta        gt        ta ta        tt        at at        tc        cg cg        ta        at                         tttttccttttatcagtgcgtctgtgtgcgtcactgcacatcacgggcacttgcccatgtagtatctttgttgtgtaatcggttacaggtaataagtattaagtaataagtattaagtattaaaaattATG     ..................................................................................................................