                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTGTCGATGCACGTGACGCATTCAAGGCTAAATACCCGAGTCGTACAGACTTCCA
GGGAGCTTGGTTGCTGTATCGTATTTATTGAtttctttttggtaatatatatcgggatggataacctgttttcccga
aataagaaggcggtaactgggaagttactgcttttttgttacacattgtaaattcgttttttagaaatttttatcattctactaaaagaagttataaata
gcaggtgggaaacttttttcgtaaataaagtttttacttttgtcattatgaaacagaaatatgtaATG

    BT0411 --- BT0412 --- BT0413 --- BT0414 --- BT0415 --- BT0416 --- BT0417 Gene: BT0411     GI: 29345821     BI number: BT0411     GOG: COG1218     Description: CysQ, sulfite synthesis pathway protein Gene: BT0412     GI: 29345822     BI number: BT0412     GOG: COG0471     Description: putative Na+/sulfate symporter Gene: BT0413     GI: 29345823     BI number: BT0413     GOG: COG0529     Description: putative adenylylsulfate kinase Gene: BT0414     GI: 29345824     BI number: BT0414     GOG: COG0175     Description: sulfate adenylyltransferase subunit 2 Gene: BT0415     GI: 29345825     BI number: BT0415     GOG: COG2895     Description: sulfate adenylyltransferase subunit 1/adenylylsulfate kinase Gene: BT0416     GI: 29345826     BI number: BT0416     GOG: NOG43921     Description: conserved hypothetical protein Gene: BT0417     GI: 29345827     BI number: BT0417     GOG: -------     Description: hypothetical protei ta a  a gc gc |  t |  g |  t |  t t  t at gc gc gc cg ta a  a ta at ta a  | t  | a  | a  | t  | g  | g  | t  | t  | t  |       gg t  |      g  a ta        ta cg        cg ta        at ta        at tg        ta A  g       gc Gc        gt Tg        cg Tg        gc At        gt Ta        at Ta        at             tttgttacacattgtaaattcgttttttagaaatttttatcattctactaaaagaagttataaatagcaggtgggaaacttttttcgtaaataaagtttttacttttgtcattatgaaacagaaatatgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1218 3'-Phosphoadenosine 5'-phosphosulfate (PAPS) 3'-phosphatase ... can be seen here [P] COG0471 Di- and tricarboxylate transporters ... can be seen here [P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here [EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here [P] COG2895 GTPases - Sulfate adenylate transferase subunit 1 ... can be seen here     ..................................................................................................................