                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions

ATCCGGAAAAGACATTTACTGTTACAGGATATGCTGACAAGGGTACTGGTTCTGCTGA
GTACAACATGAAGTTAAGTAAGAAGAGAGCTGAAGCTGTACGTGACCTGATGGTGAAT
GAATTCGGTGTACCTGCTTCTCAACTGAAGGTTGATTACAAGGGTGGTGTAGGCAATA
TGTTCTACGATGACGCTAAGTTGAGCCGTGTTGCTATCGTGGAAGAATAAtccacagttgaaa
taatagaataaaagagacgtttcctttcgcgggaagcgtcttttttgtatttttgtaccccatATG

    BT0419 Gene: BT0419     GI: 29345829     BI number: BT0419     GOG: COG0816     Description: putative endonucleas            c          t  g          t  c           tg           cg           cg           ta           ta           tg           gc           cg           at           gc           at           gt           at           at           at             tgtatttttgtaccccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0816 Predicted endonuclease involved in recombination (possible Holliday junction resolvase in Mycoplasmas and B. subtilis) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=71 nt.     Delta G= -9.50 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCCGGAAAAGACATTTACTGTTACAGGATATGCTGACAAGGGTACTGGTTCTGCTGA GTACAACATGAAGTTAAGTAAGAAGAGAGCTGAAGCTGTACGTGACCTGATGGTGAAT GAATTCGGTGTACCTGCTTCTCAACTGAAGGTTGATTACAAGGGTGGTGTAGGCAATA TGTTCTACGATGACGCTAAGTTGAGCCGTGTTGCTATCGTGGAAGAATAAtccacagttgaaa taatagaataaaagagacgtttcctttcgcgggaagcgtcttttttgtatttttgtaccccatATG     BT0419 Gene: BT0419     GI: 29345829     BI number: BT0419     GOG: COG0816     Description: putative endonucleas             g           a  a           a  g           a  a            ac            tg            at            at            gt           a  c            tc            at           a  t           t  t           a  c            ag            a            g   A        t A  T      | G  A      t A  A      g At       a          c Gc       c        t  g Gc       a        t  c Ta        c        tg Gc        c        cg C  a       t        cg Tg       A         ta At       A         ta T  t      T         tg C  g       A        gc G  a       A        cg Ta       |         at Ta        G        gc Gt        A        at Ta        A        gt                         ttttgtatttttgtaccccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0816 Predicted endonuclease involved in recombination (possible Holliday junction resolvase in Mycoplasmas and B. subtilis) ... can be seen here     ..................................................................................................................