                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:45 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=37 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACA-TACGAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACATCTGTTCTCGCACACCGTACGATGCTGGAAGCCGGACTGAAAAAGAAAGACC
GGCAAAACAAAGCATTGGTGGATGAGATAAGTGCCACTATTATTCTGCAAACATATTT
GGAGAGTAAACGTTTTTAAtaataagacagagaataatttaattttttagtagagtataaagtATG

    BT0420 Gene: BT0420     GI: 29345830     BI number: BT0420     GOG: COG0242     Description: peptide deformylase(PDF   A A  A A  G A  A G  A TA         A CG       G  T A  A      A  A GC       G  A GC        TG CG        AT CG       |  G GC        GC |  A       GC        AT |  A       TA       C  A |  A       GC        AT A  A       GT        AT A  C       TA        AT G  A      |  T       CG G  A      |  T      G  G TA       |  A       TA CG       |  T       CG GC       |  T       TA TA       T  C       TG AT        AT        AT GT        CG        TA CG        GC        TA                         ACGTTTTTAAtaataagacagagaataatttaattttttagtagagtataaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0242 N-formylmethionyl-tRNA deformylase ... can be seen here     ..................................................................................................................