                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGGCACGCAGCAGAATGTTCGAAAGTTAAactaccgttactttatgcaaagagttatggtaaaggaagatttt
aaattaaagctcaaaaaatattcagaatccttttgttttctcaaataaagctgtaattttgcacgccgtaaacgagaaacaaaccGCCGCTATA
GCTCAGTTGGTAGAGCAACGCATTCGTAACGCGTAGGTCGCCAGTTCAAGTCTGGCTA
GCGGCTcttgacaataaagcgctaactacagaatagttagcgcttttcttattaacccccaaagcaaatcgcATG

    BT0432 Gene: BT0432     GI: 29345842     BI number: BT0432     GOG: COG1864     Description: putative endonuclease BB041             c           a  a           g  a           t  t           t  a           c  a            Ta GT        Cg A  C      G  |        g AT        Gc       a  a CG        Cg       c  a T  |       Gc        at TG        At        ta GC        Ta        cg AT       |  a       at C  A      |  c       at CG       C  t       ta GC       G  a       cg CG        Gc        gc TG        Ta        cg GC        Cg        gc GT        Ta        at                         tttcttattaacccccaaagcaaatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1864 DNA/RNA endonuclease G, NUC1 ... can be seen here     ..................................................................................................................