                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:95 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-19.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-tatagt. It has a score value of 70.28 and is shown in blue

ttgaccacagtatatcccccaagatatagtcagtcagatatagccgaccgcttgattttccccaatcaagcggtttgttgtattcatctacgttgacaat
ataatttttatatcccatatcaaagaaaagcgggtatccggacaaccagatgcccgttttttttgttatatttgtattatcccttaaaaaatgataattA
TG

    BT0483 --- BT0484 Gene: BT0483     GI: 29345893     BI number: BT0483     GOG: -------     Description: putative outer membrane protein, probably involved in nutrient binding Gene: BT0484     GI: 29345894     BI number: BT0484     GOG: -------     Description: putative outer membrane protein, probably involved in nutrient bindin           ca          a  a           gc           gc          c  a           cg           ta           at           tg           gc           gc           gc           cg           gt           at           at           at           at             tttgttatatttgtattatcccttaaaaaatgataattATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.30 kcal/mol Antiterminator: Size=35 nt.     Delta G= -3.80 kcal/mol Anti-antiterminator:   Size=43 nt.     Delta G=-15.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCTATGGCTACGGATACGGTTACGGACAGGAAAAAGGTGCTAAATCGTAAtccggttctaaga ataaacctgagaataaacgatagcccgtttcaatctgattgaccacagtatatcccccaagatatagtcagtcagatatagccgaccgcttgattttccc caatcaagcggtttgttgtattcatctacgttgacaatataatttttatatcccatatcaaagaaaagcgggtatccggacaaccagatgcccgtttttt ttgttatatttgtattatcccttaaaaaatgataattATG     BT0483 --- BT0484 Gene: BT0483     GI: 29345893     BI number: BT0483     GOG: -------     Description: putative outer membrane protein, probably involved in nutrient binding Gene: BT0484     GI: 29345894     BI number: BT0484     GOG: -------     Description: putative outer membrane protein, probably involved in nutrient bindin cc c  a c  a cg ta at        at ta       g  a at       a  t ta       c  a g  |       tg a  |       gc c  |      a  c       cc a  |       cg       t  c c  |       ta       t  c cg        gc        ta at       a  c       ta gc       t  g       at ta       a  |       gc tg       t  |       ta at       a  |       ta gc        gc        cg ta        at        gc cg        at        cg ta        cg        cg                         tttgttgtattcatctacgttgacaatataatttttatatcccatatcaaagaaaagcgggtatccggacaaccagatgcccgttttttttgttatatttgtattatcccttaaaaaatgataattATG     ..................................................................................................................