                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.51 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGTGAAGATTAGTTATTGAtacgataccggtctgttattttcagaacattttatgcatccgggaatgtgataaaacgattgctt
cccggatgttttataaataagcgacagatttggcattgatgatttcaacgataatcatgtctgcctgaccgatttttagtatttttggcgattgtaagta
agcgattcaaagtcttatcagattgtattacggattatgataaaaagaagatggacgaaatgcttcattattacgaatgtaaaggcagtaaaataattag
tttgaatgacctattATG

    BT0505 Gene: BT0505     GI: 29345915     BI number: BT0505     GOG: COG4430     Description: conserved hypothetical protei             t   a       a  t g  a      t  t t  t      t  t tg        gc ta        ta gc        cg        aa a  c       ta       a  c t  t      |  a      a  g ta       |  c       ta at       |  a       at at       |  t       gt tA       |  t       tg aT       |  t       gc |  G      |  t      t  | |  c      |  a       at a  c      |  t       at a  g      |  g       gc a  g      |  c       gc t  t      |  a       gc gc       |  t       cg at        gc        cg cg        gc        ta gt        cg        at gt        cg        cg                         ttttataaataagcgacagatttggcattgatgatttcaacgataatcatgtctgcctgaccgatttttagtatttttggcgattgtaagtaagcgattcaaagtcttatcagattgtattacggattatgataaaaagaagatggacgaaatgcttcattattacgaatgtaaaggcagtaaaataattagtttgaatgacctattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4430 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................