                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G= -7.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAGTATACCGATGCGATGACACGTACTATCTTTGTCTTTTTTCAGGGGATGAAGCA
GAAGTACCCGCACCTGAATATAGGTATCACCGATTTCTTTATTCATCTCAATACGGTA
TGGCTGTTTGCCTTGCTCGAAGAACTGGTGCTGCACCACGTGAAGAAAGAAGAAATGC
AGAAATTTATAGCAGAATATATAGCCTTTGAAACGGCAGGTTGGAAGGAGCTCATGAA
TGTATGAgctccttctttttttgaacgattcagaggaatgttcttttttaaaaatcagatatatataaATG

    BT0508 --- BT0509 Gene: BT0508     GI: 29345918     BI number: BT0508     GOG: COG1132     Description: ABC transporter ATP-binding protein Gene: BT0509     GI: 29345919     BI number: BT0509     GOG: COG1132     Description: ABC transporter ATP-binding/transmembrane protei   A A  A G  T A  G A  C G  A A  G A  A A  A G  A AT AT GT TA GT C  A A  | C  | C  | A  | CG GC TA CG |  A |  A        C        AT |  T      G  A      A  G G  A      G  G       GT T  T       CG        TA G  A       AT        AT GT        AT        CG TA       A  G       TA CG       G  G       Cg A  C       TA        Gc A  |       TA        At GC        TG        Gc AT        CG        Gc AT       |  A       At GT        CG        At CG        GC        Gc TA        AT        Gt                         ttttttgaacgattcagaggaatgttcttttttaaaaatcagatatatataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here     ..................................................................................................................