Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions

ATGAAAAATGGTGGAATGATTTTGATGTAAACAAGGTATTCCAAACAAATAAAAACTA
Atctcccttatcaacacggatttcataaaaaaaatgaaatccgtgtttttttcctcactaaatgtatcagatatattctattaataaataaaaataataa
tctccatgaattttacttctgctaattggaaatttattctaaaattatatatatatttgcacgaagtgaaacaaagacaagagattcaatttaatctata
taaatcaagtagcaaagcaagcgatagaaaggttctatttgtATG

    BT0524 --- BT0523 --- BT0522 --- BT0521


Gene: BT0524     GI: 29345934     BI number: BT0524     GOG: COG0745     Description: putative two-component system response regulator
Gene: BT0523     GI: 29345933     BI number: BT0523     GOG: COG2148     Description: putative glycosyltransferase
Gene: BT0522     GI: 29345932     BI number: BT0522     GOG: -------     Description: hypothetical protein
Gene: BT0521     GI: 29345931     BI number: BT0521     GOG: COG0110     Description: putative acetyl transferas


           a
         a  a
         a  a
         a  a
          ta
          at
          cg
          ta
          ta
          ta
          at
          gc
          gc
          cg
          at
          cg
          at
          at
            tttttcctcactaaatgtatcagatatattctattaataaataaaaataataatctccatgaattttacttctgctaattggaaatttattctaaaattatatatatatttgcacgaagtgaaacaaagacaagagattcaatttaatctatataaatcaagtagcaaagcaagcgatagaaaggttctatttgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here
[M] COG2148 Sugar transferases involved in lipopolysaccharide synthesis ... can be seen here
[R] COG0110 Acetyltransferase (isoleucine patch superfamily) ... can be seen here

    ..................................................................................................................