                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:37 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-tatatt. It has a score value of 63.59 and is shown in blue

ttgttgtttcaaacaaagtgtctatatttgtccccgataaataacaaaagacaatgagaacaatgttagtaaatacatattggtggtggcgcccgttaca
actccgacagtcgtaagggagcagtgctcgtatgtatatacctcattaaagatataacaaatttgaaagagccctgtcgcaacctgcgacagggctcttt
ttatttgcccgtttttgaaaatcgaataaataataataaataaaaataggattATG

    BT0533 Gene: BT0533     GI: 29345943     BI number: BT0533     GOG: COG0133     Description: tryptophan synthase beta chai            c          a  c          a  t           cg           gc           cg           ta           gc           ta           cg           cg           cg             ctctttttatttgcccgtttttgaaaatcgaataaataataataaataaaaataggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:137 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-28.70 kcal/mol Antiterminator:    Distance from promoter:106 nt. Size=68 nt.     Delta G=-10.20 kcal/mol Anti-antiterminator:    Distance from promoter:81 nt.    Size=44 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgttg-tatatt. It has a score value of 63.59 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgttgtttcaaacaaagtgtctatatttgtccccgataaataacaaaagacaatgagaacaatgttagtaaatacatattggtggtggcgcccgttaca actccgacagtcgtaagggagcagtgctcgtatgtatatacctcattaaagatataacaaatttgaaagagccctgtcgcaacctgcgacagggctcttt ttatttgcccgtttttgaaaatcgaataaataataataaataaaaataggattATG     BT0533 Gene: BT0533     GI: 29345943     BI number: BT0533     GOG: COG0133     Description: tryptophan synthase beta chai            tg           t  a           t  a            aa            ag           a  a            cg            ac            ac            tc           a  |            tt            ag            gt           |  c           |  g gt       |  c c  a      |  a t  t       aa cg        ac gt       |  c ta       |          c gt       a        a  c |  a       t       a  t |  t       t        cg a  a       a        gc c  c       c        cg gc       t         ta at        c        gc gc        c        ta g  a       a        cg g  t       t        cg a  t      |         cg a  a      |         gc t  a      |         at g  a      a         gc cg       t         at ta        a        at gt        t        at                         ttatttgcccgtttttgaaaatcgaataaataataataaataaaaataggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here     ..................................................................................................................