                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.00 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=38 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:23 nt.    Size=52 nt.     Delta G= -6.65 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-taaact. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaattttagatgtctgaaataaactcatatctttgaatatatattcatcagtttgtaaagtcaggaataaaaagtatagacttctatgcataaaa
agctgtcaattaacgcagattagcataataacaggctgatctgtgttttattttttataattttggactcataaactttttaaatgtactatcaatgaag
ataaaaagaattattctaATG

    BT0550 Gene: BT0550     GI: 29345960     BI number: BT0550     GOG: COG0584     Description: putative glycerophosphodiester phosphodiesteras ct a  t gc at ta at tg gc a  a a  t a  a a  a a  a       tt t  |      a  a a  |      a  a a  |      c  c g  |       tg        ta g  |       gc       a  a a  |       ta       a  c c  |       cg       t  a t  |      g  a      a  g g  |      a  |       cg a  |      a  |       gc a  |      a  |       at a  |       at        tg t  |       at        ta g  |       ta        at ta       a  |       gc ta        cg        at tg        gc        cg gc        ta        gt at        at        cg cg        ta        at                         tttattttttataattttggactcataaactttttaaatgtactatcaatgaagataaaaagaattattctaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0584 Glycerophosphoryl diester phosphodiesterase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:83 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.30 kcal/mol Antiterminator:    Distance from promoter:48 nt. Size=38 nt.     Delta G= -6.20 kcal/mol Anti-antiterminator:    Distance from promoter:48 nt.    Size=16 nt.     Delta G= -4.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-taaact. It has a score value of 80.99 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaaaaattttagatgtctgaaataaactcatatctttgaatatatattcatcagtttgtaaagtcaggaataaaaagtatagacttctatgcataaaa agctgtcaattaacgcagattagcataataacaggctgatctgtgttttattttttataattttggactcataaactttttaaatgtactatcaatgaag ataaaaagaattattctaATG     BT0550 Gene: BT0550     GI: 29345960     BI number: BT0550     GOG: COG0584     Description: putative glycerophosphodiester phosphodiesteras            aa           a  a           a  g           t  c            at            cg        ta            gt       a  a            tc       a  c           a  a      t  a           t  |      a  g           c  |       cg           t  |       gc            ta        at ct        ct        tg a  t       at        ta gc       g  |       at at        aa        gc ta        ta        at at        ac        cg tg        tg        gt gc        gc        cg                         ttttattttttataattttggactcataaactttttaaatgtactatcaatgaagataaaaagaattattctaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0584 Glycerophosphoryl diester phosphodiesterase ... can be seen here     ..................................................................................................................