                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -7.36 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -5.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGTTGATGATATTGCCATCAAGAGCTGGGAAGAGTATAAGTAAgaaataataaattgttgtataa
taagttggaaaagtcgttcccgtgcattcgggggcggcttttttttatgaatttctgtttttgggatggtgtcactataagcatgggatagtgtcactat
cctgtcagtatgcttacactatccttcctgtatagtgtcactatctttttttaatgtctataagttgcatgattggacaaattggtgtaaattgcgcaat
tatttcacaaatattctaaaacaggggagtaatATG

    BT0558 Gene: BT0558     GI: 29345968     BI number: BT0558     GOG: COG0836     Description: mannose-1-phosphate guanylyltransferas             a           t  a           a  t           a  a           a  a           g  a            At            At            Tg           G  |            At            At            Tg            At            Ta            Gt           |  a           |  a   a       |  t t  a      |  a g  t      |  a a  A      |  g g  T      |  t g  G      |  t g  G      |  g gC       |  g aT       |  a       ca cG       |  a      g  t a  G      |  a      t  t a  G      |  a       gc a  A      |  g       cg a  |       At        cg tA        Gc        cg cG       |  g       tg tA        At        tg tG        At        gc aT        Gc        cg tA        Gc        tg aT        Gc        gc a  A       Tg        at a  A      |  t       at cG        Cg        at aT        Gc        at                         ttttatgaatttctgtttttgggatggtgtcactataagcatgggatagtgtcactatcctgtcagtatgcttacactatccttcctgtatagtgtcactatctttttttaatgtctataagttgcatgattggacaaattggtgtaaattgcgcaattatttcacaaatattctaaaacaggggagtaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0836 Mannose-1-phosphate guanylyltransferase ... can be seen here     ..................................................................................................................