                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:194 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCCGAATTCGGCATTGATGAAGCGAAATTCGTTGTGACGTACTATATTTATATCCTT
CAACAGTTGGAGGCCTAATTCCATCGGTTTCTTCTGTTCCATtttctcagttcttttccggcaaagata
agaaatagcccttgaatcttctctttttttaggatgaatcgaactattgggacatattttccaactatcagaatgtgaaactattacttaaaggtctatc
tttgtcttttgaagaattcatagaaaaaatgcgtatgaaaagaattatttttagtctttcgcttttactgttcATG

    BT0560 --- BT0561 --- BT0562 --- BT0563 --- BT0564 Gene: BT0560     GI: 29345970     BI number: BT0560     GOG: -------     Description: outer membrane efflux protein Gene: BT0561     GI: 29345971     BI number: BT0561     GOG: COG0845     Description: conserved hypothetical protein, putative membrane protein Gene: BT0562     GI: 29345972     BI number: BT0562     GOG: COG1131     Description: putative ABC transporter ATP-binding protein Gene: BT0563     GI: 29345973     BI number: BT0563     GOG: COG0842     Description: putative ABC transporter ATP-binding protein or permease protein Gene: BT0564     GI: 29345974     BI number: BT0564     GOG: COG0842     Description: putative ABC transporter permease protei GT C  A A  C GT TA GT TA T  T G  T                 TC C  T                T  C T  |                A  A TA                 A  T AT                 T  C A  A                 CG AT                  CG GC                  GT C  |                 GT GC                  AT AT         A        GC AT       C  G       GT GC        AT       T  T TA        AT       T  | A  A       CG        GC GC        TG        AT TA        TA        CG TG        CG        AT AT        CG        AT                         CCATtttctcagttcttttccggcaaagataagaaatagcccttgaatcttctctttttttaggatgaatcgaactattgggacatattttccaactatcagaatgtgaaactattacttaaaggtctatctttgtcttttgaagaattcatagaaaaaatgcgtatgaaaagaattatttttagtctttcgcttttactgttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here     ..................................................................................................................