                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=56 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCGTCAGTTGTTTCATTGGTCACCGATGGGGACCGGCTTGAAATGGTCTCTGTTTA
TCCTATGGGTATTGGGACTGGTCATCGTGATTATCAATTTGTCAGCTCTCGGATGGCA
GCTGCCGTTGTATGGACTGCATTGCTTTTAAtgtaagatcgttctattaaaaaagaataatatttattctttttctg
agaaatgtgccccgatagtgtgtctggggtacattttttgtttgtccctctttgtaaatcgagatttttaattaagtttgtgaggacttattcaatagat
aaagaaaATG

    BT0584 --- BT0585 Gene: BT0584     GI: 29345994     BI number: BT0584     GOG: COG2220     Description: putative outer membrane protein Gene: BT0585     GI: 29345995     BI number: BT0585     GOG: COG1853     Description: conserved hypothetical protei             a           t  t            at            at            ta            at            at            gc            at            at            at            at            at           a  c   T       t  t        t T  A      t  g      g  g T  A      a  |      a  t T  t       ta        tg Cg        cg        at Gt        ta        gc Ta        ta       |  t Ta       |  a       cg |  g      |  t       cg A  a      |  g       cg C  t      |  t       cg Gc       |  g       gt Tg       |  c       ta C  t      |  c       gc At       |  c       ta Gc        gc        at Gt        cg        at Ta        ta        at At        at        gt                         ttgtttgtccctctttgtaaatcgagatttttaattaagtttgtgaggacttattcaatagataaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2220 Predicted Zn-dependent hydrolases of the beta-lactamase fold ... can be seen here [R] COG1853 Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family ... can be seen here     ..................................................................................................................