                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=10 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=61 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGATTGAACTATTATTATTTCGTGTCAACACTGATTAGTGTAGGAACCATGATTTT
GTTGCGTAAAACTACAGACGAAACAAAATTACTGGCTATTCTGGAAGCTAAGAAAAAA
GACCCGAAACAAATGAAAAAGACCGGATTTGCTGCACGCCTGGAAGCTATGCAAAAGC
AACAGGAACAGTTACAGCAGCAAAAACAGAATAAACGATAAgaaattatccgaagatatattctgagaaa
gccgggcaaccgaaaggggtttgtccggctttctttctctaaaaaacaaacttaatATG

    BT0588 Gene: BT0588     GI: 29345998     BI number: BT0588     GOG: COG0534     Description: BexA, multidrug efflux pum aa g  a At At Ta At Gc |  c |  g |  a |  a |  g C  a A  t A  a At Ta At                  aa At                 g  a Gc                  cg At                  cg Cg                 |  g A  a                |  g A  g                |  t A  a                 at A  a                 at A  a                 cg Cg                  gt Gc                  gc |  c       ca        gc |  g      g  a       cg A  g       gc        cg Cg        gc        gc Gc        cg        at                         ttctttctctaaaaaacaaacttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0534 Na+-driven multidrug efflux pump ... can be seen here     ..................................................................................................................