                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:80 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=42 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGATA-Taatat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGATAATAACTCTCTTCTCATaatattcctaatttggtgcaaatctacattattttgtttagaaaacataggaatctttcaaa
attgcattttttaataaaattgtagaggggaaagtctgcattcttccccttttttttataattttgcgctttttaagttcgtaagaaactactaagtaaa
aataattaaaacagttatagctGTG

    BT0590 Gene: BT0590     GI: 29346000     BI number: BT0590     GOG: COG0504     Description: CTP synthase (UTP-ammonia ligase aa t  t ta ta ta ta t  t       gc at       t  a cg       c  t gt       t  t ta        gc tg        at a  a      a  | a  g       at a  g       gc a  g       gc cg        gc ta        gc ta        at ta        gt cg        at             tttttataattttgcgctttttaagttcgtaagaaactactaagtaaaaataattaaaacagttatagctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0504 CTP synthase (UTP-ammonia lyase) ... can be seen here     ..................................................................................................................