                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -8.47 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttgaaagtaatcattgctgtagccggtgcgattgccggagtactgggagtacaggctgcatcattgtaagcagcattcagtaaataaagtaattggtta
gataagacaggcaggcgggaagaactttcccgcctgctttgttgtatgctaaaatatcaaatagttggcgttactttttcgtgtgcgataacgaaaacac
aaaaaataacattttattatgtagaaaaaaatgagggaatgcttcgtagttcacaaataatgattaaatttgccgcgatttgtaatgttgagtttgcaaa
ATG

    BT0616 --- BT0617 --- BT0618 --- BT0619 --- BT0620 --- BT0621 --- BT0622 Gene: BT0616     GI: 29346026     BI number: BT0616     GOG: NOG47302     Description: conserved hypothetical protein Gene: BT0617     GI: 29346027     BI number: BT0617     GOG: COG2878     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnfB Gene: BT0618     GI: 29346028     BI number: BT0618     GOG: COG4656     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnfC Gene: BT0619     GI: 29346029     BI number: BT0619     GOG: COG4658     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnfD Gene: BT0620     GI: 29346030     BI number: BT0620     GOG: COG4659     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnfG Gene: BT0621     GI: 29346031     BI number: BT0621     GOG: COG4660     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnfE Gene: BT0622     GI: 29346032     BI number: BT0622     GOG: COG4657     Description: Na+-transporting NADH:ubiquinone oxidoreductase, Electron transport complex protein rnf            aa           t  a           a  g           a  t           a  a            ta            gt            at            cg            tg           t  t           a  t           c  a           g  g           a  a           c  t           g  a           a  a           a  g            ta            gc            ta            tg           a  g           c  c           t  a        a           a  g      a  c            cg        gt            gc        at tt        tg        at a  g       cg        gc c  t      g  g       gc t  a      g  a       gc a  a      a  a       cg cg       c  g       gc gc       a  a       gc ta        ta        at cg        gc        cg gc        at        gc                         tttgttgtatgctaaaatatcaaatagttggcgttactttttcgtgtgcgataacgaaaacacaaaaaataacattttattatgtagaaaaaaatgagggaatgcttcgtagttcacaaataatgattaaatttgccgcgatttgtaatgttgagtttgcaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2878 Predicted NADH:ubiquinone oxidoreductase, subunit RnfB ... can be seen here [C] COG4656 Predicted NADH:ubiquinone oxidoreductase, subunit RnfC ... can be seen here [C] COG4658 Predicted NADH:ubiquinone oxidoreductase, subunit RnfD ... can be seen here [C] COG4659 Predicted NADH:ubiquinone oxidoreductase, subunit RnfG ... can be seen here [C] COG4660 Predicted NADH:ubiquinone oxidoreductase, subunit RnfE ... can be seen here [C] COG4657 Predicted NADH:ubiquinone oxidoreductase, subunit RnfA ... can be seen here     ..................................................................................................................