                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCAGGGACTTTCACGTCTGGTAAAGGGAATGAAGGTAGAAGAGGTTATCAAGAAA
CTTGAAGGAGTACGTTGCAGTGGCAGACCGACGTCCTGTCCCGATCAGTTGTGCCATG
CACTGCATGAAATGGGATATTAAcggaagtctccctttataaaatatacactggcctccggcaattcattttgccggaggttt
tttattgtgccgtacctttccctatttgtcggtattttgaaccaaaatcgaccttcggtcgttatttataagtatatttgtgctgaataaactattatgc
aATG

    BT0629 --- BT0630 --- BT0631 Gene: BT0629     GI: 29346039     BI number: BT0629     GOG: COG1914     Description: Mn2+ and Fe2+ transport protein Gene: BT0630     GI: 29346040     BI number: BT0630     GOG: COG0708     Description: exodeoxyribonuclease Gene: BT0631     GI: 29346041     BI number: BT0631     GOG: NOG18209     Description: conserved hypothetical protei   a a  a t  a a  t t  a t  t t  a c  c c  a c  c       ca t  t      t  t cg       t  t tg        at gc        at a  c       cg at        gc gc        gc gc        cg cg        cg A  g       ta A  c       cg Ta        cg Ta        gt At        gt             ttttattgtgccgtacctttccctatttgtcggtattttgaaccaaaatcgaccttcggtcgttatttataagtatatttgtgctgaataaactattatgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1914 Mn2+ and Fe2+ transporters of the NRAMP family ... can be seen here [L] COG0708 Exonuclease III ... can be seen here     ..................................................................................................................