Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-25.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGGTGACGTAAGCCGTAAACGTAAACTGCTTGAAAAGCAGAAAAAGGGTAAAAAAC
GAATGAAACAAATCGGTAATGTGGAAGTGCCGCAGAAAGCCTTCCTCGCCGTACTGAA
GCTGGATTAAaaaatgaaccgcaagcgatttttcagagagttattctgaacaaatcggcttgcggttagttttttaatacaccaggtgattgt
cttctgtctgcagagctttccttggcaatcaccttttttgaaacaaacaactataaatatgagaaaagttctgtctttttcgggcttcctgATG

    BT0633


Gene: BT0633     GI: 29346043     BI number: BT0633     GOG: NOG40295     Description: putative Na+/H+ exchange protei


  t
g  t
a  a
 gt
 at
 gc                  ct
 at                 t  g
 cg        tt        gc
 ta       t  t       ta
 ta        gt        cg
|  c       at        ta
 ta        ta        tg
 ta        ta       |  c
 ta        gt       |  t
 at       |  a      |  t
 gc       |  c      |  t
|  g      g  a      |  c
 cg       c  c      |  c
 gc        gc       |  t
 at        ta       |  t
 at        tg        cg
 cg        cg        tg
 gc       g  |       gc
 cg        gt        ta
 cg        cg        ta
 at        ta        at
 at        at        gc
                        accttttttgaaacaaacaactataaatatgagaaaagttctgtctttttcgggcttcctgATG


    ..................................................................................................................