                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGCGCACGTTTCAGGTGCGTGTGTCGAGAGGCATGCAGGTTCGAGTCCTGTTCTGG
GCACAAgaaattcagatttctgaatggagaaaatttagtttGCGGAAATAGCTCAGTTGGTAGAGCATAACCT
TGCCAAGGTTAGGGTCGCGAGTTCGAGTCTCGTTTTCCGCTCAAagtagtgaggttgtcagtcgata
agattggcgacctctttttgtaattacgaaagtcgatgtacttcccccaaaaagagtgtcatcgactcacacagacctataattaatttaagaacttgtg
atATG

    BT0675 --- BT0676 Gene: BT0675     GI: 29346085     BI number: BT0675     GOG: COG1820     Description: N-acetylglucosamine-6-phosphate deacetylase Gene: BT0676     GI: 29346086     BI number: BT0676     GOG: COG1820     Description: N-acetylglucosamine-6-phosphate deacetylas            Aa           A  g           C  t            Ta            Cg            Gt            Cg           |  a        t            Cg       a  a   G        Tg       g  a C  A      T  t       cg T  G      T  |       ta T  T      T  |       gt GC        Gt        at AT        Cg        cg GC       T  t       tg CG       C  c       gc GT       T  a       tg C  T      G  g       ta T  T       At        gc GT        Gc        gc GC        Cg        at GC        Ta        gc                         tttttgtaattacgaaagtcgatgtacttcccccaaaaagagtgtcatcgactcacacagacctataattaatttaagaacttgtgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1820 N-acetylglucosamine-6-phosphate deacetylase ... can be seen here [G] COG1820 N-acetylglucosamine-6-phosphate deacetylase ... can be seen here     ..................................................................................................................