                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -7.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTGTTCTTCACCTGAAAACCTTCTGCCAGAATGATGCCGTTAGCCGCCGTAAAGCC
CATGGCTGAATTTTCTATCAAGAGGGAGTCATCCACCGACACATTATAAAACGGTTTG
CCGTTTTCGTCTACCGTCAATGTCATCTTGATATGTCCGTCCGGTGACTGGACCTCTG
TTTTCGGGCTACTACAGGCATAGCATCCCAGCACACACAGAAAAGCTCCAACTAAATG
TTTTACTTTCATagtataatcgtctgtttatatataatacagttcagaaaggagaaacacttaaatgtATG

    BT0682 --- BT0681 Gene: BT0682     GI: 29346092     BI number: BT0682     GOG: COG0745     Description: two-component system response regulator Gene: BT0681     GI: 29346091     BI number: BT0681     GOG: COG0642     Description: two-component system sensor histidine kinas             C           T  A           G  T           T  C            AT TT        AT T  G       CG GC        TA GC        GT CG       C  A AT       C  | AT        AT AT        TG AT       C  T |  C      T  C T  G       GC        GG A  T       CG       C  T T  C      T  T       CG T  T      T  C       TA A  A      T  |       GC C  C      T  |      |  T A  C       GC        CG CG        CG        CG AT        CG        TA GC        GT        GC                         CTCTGTTTTCGGGCTACTACAGGCATAGCATCCCAGCACACACAGAAAAGCTCCAACTAAATGTTTTACTTTCATagtataatcgtctgtttatatataatacagttcagaaaggagaaacacttaaatgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................