                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-24.90 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGCTGATTCTTGGGGATCAAAATCTACAGATTGGTACAAGAGATATCAGTCTCCC
AAGAATTAAgaaacaaaaacaatttcgatatataactgtgacacgactttgtgttctgatttgatccggtcccggtgtacttcaagcgagaaga
taccgggaccttttttgtttatttgtatacaaatatttcgggagtaaagaaatgatgatgaaaataccggcttgattattgcttttccttacattcaatt
tcggtggttggaatctattcagtacctttaccgaaaattagaggaaacATG

    BT0721 Gene: BT0721     GI: 29346131     BI number: BT0721     GOG: COG0507,COG0514     Description: DNA repair and recombination protein, putative helicas            gc           a  g           a  a            cg            ta tc        ta g  c       cg gc       a  | cg        ta cg        gt t  t       ta a  g       gc g  t       gc t  a       cg t  c       cg t  t       cg at        ta gc        gc ta        gc             ttttttgtttatttgtatacaaatatttcgggagtaaagaaatgatgatgaaaataccggcttgattattgcttttccttacattcaatttcggtggttggaatctattcagtacctttaccgaaaattagaggaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0507 ATP-dependent exoDNAse (exonuclease V), alpha subunit - helicase superfamily I member ... can be seen here [L] COG0514 Superfamily II DNA helicase ... can be seen here     ..................................................................................................................