                                                                        Gene putatively regulated by attenuation in B_thetaiotaomicron_VPI-5482

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATATGCTGGGCGAAATGTGCCGGAGCTATGAATCGCCTTTCTCGCTGGCGGATGCG
TGGATTTTTATTGCTACTTCGGGGCTGGATGACCAGTATTTCTCCCGTTCTTTGCAGG
CTGTAAATGAGGTGACACCTCAGGAAATACAGGAATTGGCACAGCGCTATTTGTGCAA
AGAGACATTAAAAGAGGTCATTGCTGGTAAAAAGTTGTCATAAtttgctttccggtatggcacttttt
gggagagaagttgtatctttgtccaaactgtaattttaatgagtaacgagtaaaactaATG

    BT0747 Gene: BT0747     GI: 29346157     BI number: BT0747     GOG: COG4642     Description: putative phosphatidylinositol-4-phosphate 5-kinas             T           T  T           A  T           G  T           G  A           T  T            GT            CG            GC        TG           |  T      A  A           |  A       GC           T  C       GC            AT        TA            GT        CG CG        GC        GT G  G       CG       |  A G  A      G  G      |  T T  T      G  |      |  T CG        TG       |  T GC        CG       |  C CG        GC       |  T T  T      C  T       GC CG        TG        GC TG        CG        GC TA        TA        CG                         TTCTTTGCAGGCTGTAAATGAGGTGACACCTCAGGAAATACAGGAATTGGCACAGCGCTATTTGTGCAAAGAGACATTAAAAGAGGTCATTGCTGGTAAAAAGTTGTCATAAtttgctttccggtatggcactttttgggagagaagttgtatctttgtccaaactgtaattttaatgagtaacgagtaaaactaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4642 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................